American Heart Journal
Volume 143, Issue 6 , Pages 11-14, June 2002

No variants in the cardiac actin gene in Finnish patients with dilated or hypertrophic cardiomyopathy☆☆☆

Department of Medicine, University of Kuopio, Finland

Received 6 August 2001; accepted 20 November 2001.

Article Outline

Abstract 

Background Dilated and hypertrophic cardiomyopathies are primary myocardial diseases that cause considerable morbidity and mortality. Although these cardiomyopathies are clinically heterogeneous, genetic factors play an important role in their etiology and pathogenesis. The defects in the cardiac actin (ACTC) gene can cause both cardiomyopathies. The aim of our study was to screen for variants in the ACTC gene in patients with dilated or hypertrophic cardiomyopathy from Eastern Finland. Materials and Methods Altogether, 32 patients with dilated and 40 patients with hypertrophic cardiomyopathy were included in the study. Commonly approved diagnostic criteria were applied, and secondary cardiomyopathies were carefully excluded. All 6 exons of the ACTC gene were amplified with polymerase chain reaction and screened for variants with single-strand conformation polymorphism analysis. Results and Conclusion We did not find any new or previously reported variants. Our results indicate that defects in the ACTC gene do not explain dilated cardiomyopathy or hypertrophic cardiomyopathy in subjects from Eastern Finland and confirm earlier results that the ACTC gene does not play an important role in the genetics of dilated or hypertrophic cardiomyopathies. (Am Heart J 2002;143:11-4.)

 

Dilated cardiomyopathy (DCM) and hypertrophic cardiomyopathy (HCM) are serious myocardial diseases, both being important causes of sudden cardiac death. DCM is characterized by left ventricular (LV) dilatation and impaired LV systolic function.1 HCM is characterized by unexplained myocardial hypertrophy and histologic myofibrillar disarray.2, 3 Genetic factors play an important role in the etiology and pathogenesis of these cardiomyopathies, although these diseases are clinically heterogeneous. DCM is familial in approximately 30% of cases,4 and HCM in two thirds of cases.5 Autosomal dominant inheritance is the most common form in both DCM and HCM.6, 7 More than 120 mutations in the genes encoding sarcomeric proteins have been reported in patients with HCM, including genes encoding β-myosin heavy chain,8 α-tropomyosin, cardiac troponin T,9, 10 cardiac myosin-binding protein C,11 myosin essential and regulatory light chain,12 troponin I,13, 14 cardiac actin (ACTC),15 and titin.16 Recently, a novel disease gene, encoding the γ2 subunit of adenosine monophosphate (AMP)-activated protein kinase, associated with HCM and Wolff-Parkinson-White syndrome was identified.17 In DCM, only a few mutations in the dystrophin, ACTC, desmin, δ-sarcoglycan, troponin T, β-myosin heavy chain, and α-tropomyosin genes have been reported.18, 19, 20, 21, 22, 23, 24, 25 Furthermore, several other chromosomal loci26, 27, 28, 29, 30, 31, 32, 33, 34 linked to DCM have been found. The ACTC gene has been estimated to explain less than 1.5% of familial DCM cases and less than 0.6% of all cases of DCM.35 The ACTC gene is interesting because it is the first gene that is associated with both diseases. Therefore, we screened the ACTC gene for variants in previously identified probands with either DCM or HCM.

Back to Article Outline

Methods 

Subjects 

All subjects who participated in this study were Finnish and underwent study at the Kuopio University Hospital, which covers a population of 250,000 inhabitants. We studied 32 patients with DCM and 40 with HCM. The diagnostic criteria for DCM were LV ejection fraction <45% to 50% and LV diastolic diameter >27 mm/m2.36 All patients with secondary causes for DCM, such as coronary artery disease, hypertension, primary valvular disease, active myocarditis, systemic disease (sarcoidosis and connective tissue disease), metabolic disease (thyrotoxicosis and diabetes), storage diseases (amyloidosis and hemochromatosis), and excessive consumption of alcohol and toxic agents, were excluded. The diagnostic criteria for HCM were LV wall thickness ≥15 mm, blood pressure ≤160/100 mm Hg, and no other causes for ventricular hypertrophy (eg, primary valvular disease).

All patients underwent evaluation with personal and family history, physical examination, 12-lead electrocardiography, and transthoracic echocardiography (M-mode, 2-dimensional, and Doppler). Furthermore, 80% of patients with DCM had undergone coronary angiography. The study protocol was approved by the Ethics Committee of the University of Kuopio and was in accordance with the Helsinki Declaration.

Laboratory methods 

Polymerase chain reaction (PCR) 

Genomic DNA was prepared from peripheral blood leukocytes either with the proteinase-K phenol-chloroform or the salt-precipitation method. All 6 exons of the ACTC gene were amplified with PCR with primers described previously22 or designed by us. We designed new primers for exons 4 and 5: 4F:CACTGAATCCGCCTACCTCC; 4R:TCGTGCCTCTACACCAGACC; 5F:CTACCTTGACCTGAATGCAC; 5R:AGA ATACCAAGACCTGCCTC. PCR was done in a volume of 6 μL containing 40 ng of genomic DNA, 3 pmol of each primer, 10 mmol/L Tris-hydrogen chloride (HCL) (pH 8.8), 50 mmol/L potassium chloride (KCL), 1.5 mmol/L of MgCl2, 0.1% Triton X-100, 200 μmol/L deoxynucleotide triphosphate (dNTP) (200 μmol/L deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP); 160 μmol/L dCTP), 0.15 units of DNA polymerase (Dynazyme DNA polymerase, Finnzymes, Finland), and 0.3 to 0.6 μCi of α-[33P] deoxycytidine (5′-)triphosphate (dCTP). The PCR conditions were denaturation at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 40 seconds, annealing at 52°C to 64°C for 45 seconds, and extension at 72°C for 45 seconds, with final extension at 72°C for 4 minutes. The PCR product was labeled with incorporation of 33P-dCTP during amplification. PCR products were digested with restriction enzymes if the length of the fragments was >270 base pairs.

Single-strand conformation polymorphism analysis (SSCP) 

The SSCP analysis was performed essentially according to Orita et al.37 PCR products were first diluted 4-fold to 16-fold with 0.1% sodium dodecyl sulphate, 10 mmol/L ethylenediamine tetraacetic acid, and then diluted (1:1) with loading mix (95% formamide, 20 mmol/L ethylenediamine tetraacetic acid, 0.05% bromphenol blue, and 0.05% xylene cyanol). After denaturation at 98°C for 3 minutes, samples were immediately cooled on ice and 3 μL of each sample were loaded onto 6% nondenaturing polyacrylamide gel (acrylamide/N,N-methylene-bis-acrylamide ratio 49:1) containing 10% of glycerol. Each sample was run at 2 different gel temperatures: 1, at 38°C for approximately 4 hours; and 2, at 29°C for approximately 5 hours. The gel was autoradiographed at −70°C.

Back to Article Outline

Results 

Clinical characteristics 

Clinical characteristics and electrocardiographic findings of the DCM and HCM probands are shown in Table I. The study group of patients with DCM consisted of 24 men and 8 women, and the mean age at the time of diagnosis was 50.3 years (range, 14 to 71 years). Dyspnea was the most common cardiac symptom, and almost half of the probands had palpitation. Almost all probands had abnormal electrocardiographic and chest x-ray findings. LV hypertrophy was found in 34% of these patients, and left atrial hypertrophy in 38%. One third of the probands had left bundle branch block. The echocardiographic findings of the probands with DCM are shown in Table II.

Table II. Echocardiographic findings of the probands with DCM
n = 32
LVEDD mm64.9 ± 1.0 (56-75 mm)
EF %26.8 ± 1.6
Valvular abnormalities (%)21 (66)
Aortic regurgitation2 (6)
Mitral regurgitation21 (66)
Grade I13 (41)
Grade II6 (19)
Grade III2 (6)
Tricuspidal regurgitation9 (28)

Data are mean ± SEM or n (%). LVEDD, left ventricular end diastolic diameter; EF, ejection fraction.

The mean ejection fraction was 27%, and LV end-diastolic diameter varied from 56 to 75 mm. Mitral regurgitation was the most common valvular abnormality in the DCM probands (66%), but only in a few patients was the regurgitation severe. Coronary angiography was performed in 80% of the probands, and none of them had significant coronary artery disease (no stenosis >50% in any main coronary artery). The rest of the patients with DCM were young and did not have any risk factors or signs of coronary artery disease and therefore were considered not to need coronary angiography.

Table I. Clinical characteristics of the probands with DCM and HCM
DCM (n=32)HCM (n=40)
Male/female24/826/14
Age (y)50 ± 2 (14-71)50 ± 2 (16-78)
Cardiac symptoms (%)30 (94)36 (90)
Dyspnea25 (78)28 (70)
Chest pain10 (31)8 (20)
Presyncope/syncope3 (9)15 (38)
Palpitation14 (44)28 (70)
NYHA I (%)7 (22)18 (45)
NYHA II (%)15 (47)17 (42.5)
NYHA III (%)9 (28)4 (10)
NYHA IV (%)1 (3)1 (2.5)
Systolic BP (mm Hg)138 ± 5130 ± 2
Diastolic BP (mm Hg)87 ± 280 ± 2
Abnormal auscultation (%)
S311 (34)0 (0)
S49 (28)33 (83)
Systolic murmur11 (34)30 (75)
Abnormal heart palpation (%)6 (19)16 (40)
Abnormal ECG (%)30 (94)39 (98)
LVH11 (34)28 (70)
LAH12 (38)12 (30)
LBBB10 (31)0 (0)
Pathologic Q waves (%)0 (0)18 (45)
Arrhythmias (%)9 (28)4 (10)

Data are mean ± SEM or n (%). BP, Blood pressure; HCM, hypertrophic cardiomyopathy; ECG, electrocardiogram; LBBB, left bundle branch block; LVH, left ventricular hypertrophy; LAH, left atrial hypertrophy.

The HCM study group consisted of 26 men and 14 women, with a mean age of 50 years (range, 16 to 78 years). Almost all probands had cardiac symptoms (90%). The most common symptoms were dyspnea and palpitation (70%) and presyncope/syncope (38%). Most of the probands had abnormal auscultation, systolic murmur being common (75%). On electrocardiogram, LV hypertrophy was found in 70% and left atrial hypertrophy in 30% of the probands. Pathologic Q-waves were detected in 45% of the probands (Table I). On echocardiography, the mean maximal thickness of the interventricular septum was 23.8 mm (15.4 to 36.1 mm) and the mean fractional shortening was 37.2% (Table III).

Table III. Echocardiographic findings in the probands with HCM
n = 40
Maximal IVS thickness (mm) in 2D echocardiography23.8 ± 0.9 (15.4-36.1)
LVEDD (mm)43.4 ± 1.2 (24.5-58.8)
LVESD (mm)27.6 ± 1.1 (16.1-43.6)
Fractional shortening (%)37.2 ± 1.6
SAM (%)5 (13)
Obstruction of LV outflow tract (%)3 (8)
Mitral regurgitation (Grade II or III) (%)12 (30)

Data are mean ± SEM or n (%). IVS, interventricular septum; LVEDD, left ventricular end diastolic dimension; LVESD, left ventricular end systolic dimension; SAM, systolic anterior motion of mitral valve; LV, left ventricle.

Five of the probands (13%) had systolic anterior movement of the mitral valve, and only 8% of the probands had an obstruction of the LV outflow tract.

Screening for variants 

We screened the entire coding region of the ACTC gene (exons 1 to 6) with the PCR-SSCP analysis as previously reported in detail. We did not, however, find any variants in the ACTC gene.

Back to Article Outline

Discussion 

The ACTC gene is a good candidate gene for both DCM and HCM, considering the function of the encoded protein. ACTC is a major constituent of the contractile apparatus and has a specific role in force generation in contraction of the heart muscle. The function of actin is to be a part of the contractile element of the heart muscle and to transmit force to adjacent sarcomeres and myocytes.22 The mutations found in DCM and HCM are located at different regions of the ACTC gene.15, 22 The mutations that cause DCM locate in a region that forms the immobilized end of the actin filament,38 whereas mutations associated with HCM affect the actin-myosin interaction, which in turn is linked to force generation.38 Mogensen et al15 suggested that HCM would be the phenotype end point in ACTC mutations if the mutation affected force generation within the sarcomere, whereas mutations affecting force transmission from the sarcomere to the surrounding syncytium would result in DCM phenotype. Takai et al39 detected 2 silent variants in the ACTC gene, but they were not responsible for DCM in Japanese patients. Mayosi et al40 found 3 intronic nucleotide variants and 1 silent variant located in the coding region. The conclusion of Mayosi et al40 was that mutations of the ACTC gene are a rare cause of DCM. In HCM, 4 disease associated mutations (Ala295Ser, Glu99Lys, Ala331Pro, Pro164Ala) have been reported in the ACTC gene.38

In this study, we screened the entire ACTC gene for variants in 32 probands with DCM and 40 probands with HCM. We did not find any new or previously reported variants. Our results indicate that defects in the ACTC gene do not explain DCM or HCM in subjects from Eastern Finland and confirm the earlier results that the ACTC gene does not play an important role in the genetics of DCM or HCM.

The genetics of DCM are largely unknown, but in HCM, known mutations explain about two thirds of the disease. HCM is known to be primarily a disease of the sarcomere, and evidence exists that also DCM may be caused by defects in the sarcomere.22, 25 Mutations in 4 known sarcomere genes have been shown to cause both cardiomyopathies. Although mutations of the ACTC gene were not found in patients with DCM and HCM from Eastern Finland, we believe that defects in other sarcomere proteins could be responsible for DCM in the Finnish population.

Back to Article Outline

Acknowledgements 

We thank Mrs Helena Ollikainen and Marja-Liisa Sutinen for their excellent assistance in conducting the study.

Back to Article Outline

References 

  1. Richardson P, McKenna W, Bristow M, et al.  Report of the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the Definition and Classification of cardiomyopathies. Circulation. 1996;93:841–842
  2. Maron BJ, Bonow RO, Cannon RO, et al.  Hypertrophic cardiomyopathy. Interrelations of clinical manifestations, pathophysiology, and therapy. N Engl J Med. 1987;316(1):780–789
  3. Maron BJ, Bonow RO, Cannon RO, et al.  Hypertrophic cardiomyopathy. Interrelations of clinical manifestations, pathophysiology, and therapy. N Engl J Med. 1987;316(2):844–852
  4. Keeling PJ, Gang Y, Smith G, et al.  Familial dilated cardiomyopathy in the United Kingdom. Br Heart J. 1995;73:417–421
  5. Marian AJ, Roberts R. The molecular genetic basis for hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2001;33:655–670
  6. Towbin JA. Pediatric myocardial disease. Pediatr Clin North Am. 1999;46:289–312
  7. Watkins H, Thierfelder L, Hwang DS, et al.  Sporadic hypertrophic cardiomyopathy due to de novo myosin mutations. J Clin Invest. 1992;90:1666–1671
  8. Geisterfer-Lowrance AA, Kass S, Tanigawa G, et al.  A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation. Cell. 1990;62:999–1006
  9. Thierfelder L, Watkins H, MacRae C, et al.  Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell. 1994;77:701–712
  10. Watkins H, McKenna WJ, Thierfelder L, et al.  Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy. N Engl J Med. 1995;332:1058–1064
  11. Bonne G, Carrier L, Bercovici J, et al.  Cardiac myosin binding protein-C gene splice acceptor site mutation is associated with familial hypertrophic cardiomyopathy. Nat Genet. 1995;11:438–440
  12. Poetter K, Jiang H, Hassanzadeh S, et al.  Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle. Nat Genet. 1996;13:63–69
  13. Kimura A, Harada H, Park JE, et al.  Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy. Nat Genet. 1997;16:379–382
  14. Mörner S, Richard P, Kazzam E, et al.  Deletion in the cardiac troponin I gene in a family from northern Sweden with hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2000;32:521–525
  15. Mogensen J, Klausen IC, Pedersen AK, et al.  Alpha-cardiac actin is a novel disease gene in familial hypertrophic cardiomyopathy. J Clin Invest. 1999;103:R39–R43
  16. Satoh M, Takahashi M, Sakamoto T, et al.  Structural analysis of the titin gene in hypertrophic cardiomyopathy: identification of a novel disease gene. Biochem Biophys Res Commun. 1999;262:411–417
  17. Blair E, Redwood C, Ashrafian H, et al.  Mutations in the gamma(2) subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis. Hum Mol Genet. 2001;10:1215–1220
  18. Olson TM, Kishimoto NY, Whitby FG, et al.  Mutations that alter the surface charge of alpha-tropomyosin are associated with dilated cardiomyopathy. J Mol Cell Cardiol. 2001;33:723–732
  19. Towbin JA, Hejtmancik JF, Brink P, et al.  X-linked dilated cardiomyopathy. Molecular genetic evidence of linkage to the Duchenne muscular dystrophy (dystrophin) gene at the Xp21 locus. Circulation. 1993;87:1854–1865
  20. Muntoni F, Cau M, Ganau A, et al.  Brief report: deletion of the dystrophin muscle-promoter region associated with X-linked dilated cardiomyopathy. N Engl J Med. 1993;329:921–925
  21. Ortiz-Lopez R, Li H, Su J, et al.  Evidence for a dystrophin missense mutation as a cause of X-linked dilated cardiomyopathy. Circulation. 1997;95:2434–2440
  22. Olson TM, Michels VV, Thibodeau SN, et al.  Actin mutations in dilated cardiomyopathy, a heritable form of heart failure. Science. 1998;280:750–752
  23. Li D, Tapscoft T, Gonzalez O, et al.  Desmin mutation responsible for idiopathic dilated cardiomyopathy. Circulation. 1999;100:461–464
  24. Tsubata S, Bowles KR, Vatta M, et al.  Mutations in the human delta-sarcoglycan gene in familial and sporadic dilated cardiomyopathy. J Clin Invest. 2000;106:655–662
  25. Kamisago M, Sharma SD, DePalma SR, et al.  Mutations in sarcomere protein genes as a cause of dilated cardiomyopathy. N Engl J Med. 2000;343:1688–1696
  26. Durand JB, Bachinski LL, Bieling LC, et al.  Localization of a gene responsible for familial dilated cardiomyopathy to chromosome 1q32. Circulation. 1995;92:3387–3389
  27. Siu BL, Niimura H, Osborne JA, et al.  Familial dilated cardiomyopathy locus maps to chromosome 2q31. Circulation. 1999;99:1022–1026
  28. Krajinovic M, Pinamonti B, Sinagra G, et al.  Linkage of familial dilated cardiomyopathy to chromosome 9. Heart Muscle Disease Study Group. Am J Hum Genet. 1995;57:846–852
  29. Jung M, Poepping I, Perrot A, et al.  Investigation of a family with autosomal dominant dilated cardiomyopathy defines a novel locus on chromosome 2q14-q22. Am J Hum Genet. 1999;65:1068–1077
  30. Bowles KR, Gajarski R, Porter P, et al.  Gene mapping of familial autosomal dominant dilated cardiomyopathy to chromosome 10q21-23. J Clin Invest. 1996;98:1355–1360
  31. Messina DN, Speer MC, Pericak-Vance MA, et al.  Linkage of familial dilated cardiomyopathy with conduction defect and muscular dystrophy to chromosome 6q23. Am J Hum Genet. 1997;61:909–917
  32. Olson TM, Keating MT. Mapping a cardiomyopathy locus to chromosome 3p22-p25. J Clin Invest. 1996;97:528–532
  33. Kass S, MacRae C, Graber HL, et al.  A gene defect that causes conduction system disease and dilated cardiomyopathy maps to chromosome 1p1-1q1. Nat Genet. 1994;7:546–551
  34. Sylvius N, Tesson F, Gayet C, et al.  A new locus for autosomal dominant dilated cardiomyopathy identified on chromosome 6q12-q16. Am J Hum Genet. 2001;68:241–246
  35. Tesson F, Sylvius N, Pilotto A, et al.  Epidemiology of desmin and cardiac actin gene mutations in a European population of dilated cardiomyopathy. Eur Heart J. 2000;21:1872–1876
  36. Manolio TA, Baughman KL, Rodeheffer R, et al.  Prevalence and etiology of idiopathic dilated cardiomyopathy (summary of a National Heart, Lung, and Blood Institute workshop). Am J Cardiol. 1992;69:1458–1466
  37. Orita M, Iwahana H, Kanazawa H, et al.  Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A. 1989;86:2766–2770
  38. Olson TM, Doan TP, Kishimoto NY, et al.  Inherited and de novo mutations in the cardiac actin gene cause hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2000;32:1687–1694
  39. Takai E, Akita H, Shiga N, et al.  Mutational analysis of the cardiac actin gene in familial and sporadic dilated cardiomyopathy. Am J Med Genet. 1999;86:325–327
  40. Mayosi BM, Khogali S, Zhang B, et al.  Cardiac and skeletal actin gene mutations are not a common cause of dilated cardiomyopathy. J Med Genet. 1999;36:796–797

☆ Reprint requests: Keijo Peuhkurinen, MD, PhD, Professor Department of Medicine, Kuopio University Hospital, PO Box 1777, 70211 Kuopio, Finland.

☆☆ E-mail: Keijo.Peuhkurinen@kuh.fi

PII: S0002-8703(02)00028-5

doi:10.1067/mhj.2002.122514

American Heart Journal
Volume 143, Issue 6 , Pages 11-14, June 2002

Article Tools